A pipeline to handle Ribosome Profiling analysis, from pre-processing to statistical analysis.
647
RiboProAnalysis is a pipeline for Ribosome Profiling analysis for all eukaryotic genome from Ensembl 75+. It performs pre-processing steps (quality control, filtering, trimming and size selection), reads mapping to rRNA and reference genome, counting on CDS for each gene and differential analysis from raw Ribosome Profiling data.
##Use : RiboProAnalysis can be used via a Docker image (URL) and a standard Bash script with several cases : it can performs demultiplexing on multiplexed FASTQ (reads MUST begin with the index sequence) and use of RNA-seq counts to give a study of the mode of regulation of the translation. If you use FASTQ files (no demultiplexing), the extension have to be .fastq
A configuration file .conf is mandatory to laucun the program. If there is no use of RNA-seq counts, a tabulated design file, target.txt, is needed. User have to build rRNA and genome index before start with the pipeline. If you have RNA-seq counts, files must be named : SAMPLENAME_mRNAcounts.txt
bowtie-build rRNA.fasta rRNA
STAR --runMode genomeGenerate --genomeDir /path/to/genome/index --genomeFastaFiles /path/to/genome/fasta1 /path/to/genome/fasta2 ... --sjdbGTFfile /path/to/gtf/annotations \
--sjdbOverhang 28
Create a tmp/ directory in your working directory with command mkdir tmp/
Run RiboProAnalysis container with following command in the working directory :
-v /path/to/rRNA/index:**/rRNAindexdirectory** -v /path/to/genome/index:**/genomeindexdirectory** -v /path/to/directory/containig/GTF/Ensembl/annotations:**/root -v $(pwd)/tmp:/tmp **\
**genomicpariscentre/riboproanalysis bash -c "riboproanalysisDocker.sh** My_configuration_file.conf"
```
Run RiboProAnalysis bash program with following command in the working directory :
riboproanalysis.sh MyConfigurationFile.conf
### Available variables to set in the configuration file
| Variables | Explanation | Choices/Examples | Default |
|------------------------------------|---------------------------------------------------------------------------------------------------------------------------------------|----------------------------------------------------------------------|-------------------------------------------|
| PATH_TO_GENOME_INDEX | Absolute path to genome index previously built with STAR | /absolute/path/to/genome/index/ | Mandatory (if not Docker mode) |
| PATH_TO_rRNA_INDEX | Absolute path to rRNA index previously built with Bowtie1 | /absolute/path/to/rRNA/index | Mandatory (if not Docker mode) |
| PATH_TO_ANNOTATION_FILE | Absolute path to GTF annotations file (Ensembl 75) | /absolute/path/to/gtf/annotations | Mandatory |
| USER_IDS | Result of the bash command : $(id -u):$(id -g) | UserId:GroupId | Mandatory (if Docker mode) |
| SAMPLE_ARRAY | Array containing sample names (if demultiplexing) or FASTQ file for each sample | (Sample1 Sample 2 Sample 3) OR (Samp1.fastq Samp2.fastq Samp3.fastq) | Mandatory |
| ADAPTER_SEQUENCE_THREE_PRIME | Adapter sequence for 3' trimming | AAAAAAAGGTCCTAA | Mandatory |
| STRANDED | Answer for stranded option of HTSeq-Count | yes/no/reverse | Mandatory |
| PATH_TO_RAW_UNDEMULTIPLEXED_FILE | Absolute path to multiplexed FASTQ file | /absolute/path/to/multiplexed/fastq | Mandatory for demultiplexing |
| SAMPLE_INDEX_ARRAY | Array containing 5' index used for demultiplexing. Respect same order as in SAMPLE_ARRAY so index match with respective sample name | (IndexSamp1 IndexSamp2 IndexSamp3) | Mandatory for demultiplexing. Never empty |
| ANSWER_REMOVE_POLYN_READS | Option to remove reads containing more than 2 N bases (cutadapt –max-n 2) | YES / NO | NO |
| ANSWER_DEMULTIPLEXING | Option to launch demultiplexing step | YES / NO | NO |
| ANSWER_REMOVE_PCR_DUPLICATES | Option to launch PCR duplicates removing | YES / NO | NO |
| ANSWER_RNASEQ_COUNTING | Option to launch Babel OR SARTools for differential analysis | YES / NO | NO |
| ANSWER_KEEP_MULTIREAD | Option to keep multi-reads in a distinct SAM file | YES / NO | NO |
| DIFFERENTIAL_ANALYSIS_PACKAGE | Choice of the R package launched by SARTools | DESEQ2 / EDGER | EDGER |
| CONDITION_ARRAY | Array containig condition name of each sample respecting the same order | (Cond_Samp1 Cond_Samp2 Cond_Samp3) | Mandatory with Babel |
| AUTHOR | Author's name | UserName | Mandatory for SARTools |
| REFERENCE_CONDITION | Reference condition for the statistical analysis of SARTools | WT | Mandatory for SARTools |
| CHECK_DOCKER_IMAGES | Check the tags of Docker images | YES / NO | NO
##Installation :
This software could be launched from a Docker container launcheing Docker containers itself, or from a Bash script launchine Docker containers.
You should :
* Install Docker on your computer
* Pull following docker images from the Genomic Paris Centre Docker public repository :
* genomicpariscentre/fastqc:0.11.5
* genomicpariscentre/cutadapt:1.8.3
* genomicpariscentre/bowtie1:1.1.1
* genomicpariscentre/star:2.5.1b
* genomicpariscentre/gff3-ptools:0.4.0
* genomicpariscentre/samtools:0.1.19
* genomicpariscentre/htseq:0.6.1p1
* genomicpariscentre/babel:0.3-0
* genomicpariscentre/sartools:1.3.2
* Pull RiboProAnalysis image
##Input files :
###Configuration file :
You have to create your configuration file .conf in the working directory. It is a little Bash script which is imported in the main Bash script.
You put mandatory and interesting variables presented in **Available variables to set in the configuration file**.
The syntax to declare a variable is :
export VARIABLE_NAME=MyVariable
###Target file (if SARTools is used) :
The target file should include following columns : label, files, group
* **label** the sample label
* **files** the Ribosome Profiling counts files. Syntaxe if demultiplexing : SAMPLENAME_htseq.txt (ex : sample MB1 --> MB1_htseq.txt). Syntaxe if no demultiplexing : BASENAME_FASTQFILE_htseq.txt (ex : file MB1.toto.fastq --> MB1.toto_htseq.txt)
IF you use Babel without demultiplexing, you have to name your FASTQ file : SAMPLENAME.fastq --> your file after HTSeq-Count will be SAMPLENAME_RPcounts.txt and your count files for RNA-seq will must be SAMPLENAME_mRNAcounts.txt.
* **group** the group/condition given to a sample
####Model of configuration file for run with Bash script
export PATH_TO_RAW_UNDEMULTIPLEXED_FILE=/import/disir01/bioinfo/RiboPro/Riboprotma_project/2015_240_NoIndex_L008_R1_001.fastq export PATH_TO_GENOME_INDEX=/import/disir01/bioinfo/RiboPro/IndexAlignement/STAR/yeastGenomeEnsembl export PATH_TO_rRNA_INDEX=/import/disir01/bioinfo/RiboPro/IndexAlignement/Bowtie1/rRNALevureNCBI export PATH_TO_ANNOTATION_FILE=/import/rhodos01/shares-net/bioinfo/RiboPro/FichiersLevure/GenomeAnnotations_Ensembl/Saccharomyces_cerevisiae.R64-1-1.75.gtf export ANSWER_DEMULTIPLEXING=YES export ANSWER_REMOVE_PCR_DUPLICATES=YES export ANSWER_RNASEQ_COUNTING=NO export DIFFERENTIAL_ANALYSIS_PACKAGE=EDGER export SAMPLE_ARRAY=(RT1 RT11 RT7 RT13) export SAMPLE_INDEX_ARRAY=(NNNGGTTNN NNNAACCNN NNNTTAGNN NNNCGGANN) export ADAPTER_SEQUENCE_THREE_PRIME=AGATCGGAAGAGCGGTTCAG export STRANDED=yes export AUTHOR=User export REFERENCE_CONDITION=WildType
####Model of configuration file for run with Docker container
export USER_IDS=2747:100 export PATH_TO_RAW_UNDEMULTIPLEXED_FILE=$(pwd)/2015_240_NoIndex_L008_R1_001.fastq export PATH_TO_ANNOTATION_FILE=/import/rhodos01/shares-net/bioinfo/RiboPro/FichiersLevure/GenomeAnnotations_Ensembl/Saccharomyces_cerevisiae.R64-1-1.75.gtf export ANSWER_DEMULTIPLEXING=NO export ANSWER_REMOVE_PCR_DUPLICATES=YES export ANSWER_RNASEQ_COUNTING=YES export SAMPLE_ARRAY=(RT1.fastq RT2.fastq RD1.fastq RD2.fastq) export CONDITION_ARRAY=(RT RT RD RD) export SAMPLE_INDEX_ARRAY=(NA) export ADAPTER_SEQUENCE_THREE_PRIME=AGATCGGAAGAGCGGTTCAG export STRANDED=yes
####Model of target.txt file
label files group RT1 RT1_htseq.txt RT RT2 RT2_htseq.txt RT RD1 RD1_htseq.txt RD RD2 RD2_htseq.txt RD
##Workflow :



Content type
Image
Digest
Size
180.6 MB
Last updated
about 10 years ago
docker pull alexandrabomane/riboproanalysis