Conda-based FAST-iCLIP build. No data ("configure" installation step) included.
206
Fully Automated and Standardized iCLIP (FAST-iCLIP) is a fully automated tool to process iCLIP data. Please cite the following paper:
Zarnegar B, Flynn RA, Shen Y, Do BT, Chang HY, Khavari PA. Ultraefficient irCLIP pipeline for characterization for protein-RNA interactions. Nature Methods (2016)
This package contains two main sets of tools: an executable called fasticlip to run iCLIP on human and mouse data, and several (possibly deprecated) iPython notebooks to process iCLIP data from viral genomes.
The following README will focus mainly on fasticlip. The pdf in the repository contains further instructions for using the iPython notebooks.
Table of Contents
fasticlip [-h] -i INPUT [INPUT ...] [--trimmed] [--GRCh38 | --GRCm38] -s STAR_INDEX -n NAME -o OUTPUT [-f N] [-a ADAPTER] [-tr REPEAT_THRESHOLD_RULE] [-tn NONREPEAT_THRESHOLD_RULE] [-tv EXOVIRUS_THRESHOLD_RULE] [-sr STAR_RATIO] [-bm BOWTIE_MAPQ] [-q Q] [-p P] [-l L] [--verbose]
Example: fasticlip -i rawdata/example_MMhur_R1.fastq rawdata/example_MMhur_R2.fastq --GRCm38 -s docs/GRCm38/GRCm38_STAR/ -n MMhur -o results
Example: fasticlip -i rawdata/example_Hmhur_R1.fastq rawdata/example_Hmhur_R2.fastq --GRCh38 -s docs/GRCh38/GRCh38_STAR/ -n Hmhur -o results
Note that the current pipeline is compatible with only GRCh38 (human) and GRCm38 (mouse) assemblies. This is due to a tailored set of annotations used in the pipeline. We will release details of generating annotation files for other genomes shortly in future.
| flag | description |
|---|---|
| -h, --help | show this help message and exit |
| -i INPUT(s) | At least one input FASTQ (or fastq.gz) files; separated by spaces |
| --GRCh38 | required if your CLIP is from human |
| --GRCm38 | required if your CLIP is from mouse |
| -s STAR_INDEX | Path to STAR index for your organism |
| -n NAME | Name of output directory |
| -o OUTPUT | Name of directory where output directory will be made |
| flag | description |
|---|---|
| --trimmed | flag if files are already trimmed |
| -f N | Number of bases to trim from 5' end of each read. Default is 14. If using irCLIP RT primers, this value should be 18. |
| -a ADAPTER | 3' adapter to trim from the end of each read. Default is AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG. |
| -tr REPEAT_THRESHOLD_RULE | m,n: at least m samples must each have at least n RT stops mapped to repeat RNAs. Default is 1,4 (1 sample); 2,3 (2 samples); x,2 (x>2 samples) |
| -tv EXOVIRAL_THRESHOLD_RULE | m,n: at least m samples must each have at least n RT stops mapped to viral genome. Default is 1,4 (1 sample); 2,3 (2 samples); x,2 (x>2 samples) |
| -tn NONREPEAT_THRESHOLD_RULE | m,n: at least m samples must each have at least n RT stops mapped to nonrepeat RNAs. Default is 1,4 (1 sample); 2,3 (2 samples); x,2 (x>2 samples) |
| -sr STAR_RATIO | Maximum mismatches per base allowed for STAR genome mapping (corresponds to outFilterMismatchNoverLmax). Default is 0.08 (2 mismatches per 25 mapped bases). |
| -bm BOWTIE_MAPQ | Minimum MAPQ (Bowtie alignment to repeat/tRNA/retroviral indexes) score allowed. Default is 42. |
| -q Q | Minimum average quality score allowed during read filtering. Default is 25. |
| -p P | Percentage of bases that must have quality > q during filtering. Default is 80. |
| -l L | Minimum length of read. Default is 15. |
| --verbose | Prints out lots of things :) |
Clone this repository by running one of the following:
git clone [email protected]:ChangLab/FAST-iCLIP.git if you use ssh authenticationgit clone https://github.com/ChangLab/FAST-iCLIP.git otherwiseType cd FAST-iCLIP to enter the folder.
Run ./configure. This will check for dependencies (below) and download necessary files (bowtie indices, gene lists and genomes, and example iCLIP data). Note that the configure will download a very large annotation file from Amazon that contains all necessary annotation files to run the pipeline. Please wait until all annotations are downloaded and extracted. No additional annotation file is needed. The annotations are compatible only with the tools specificed in the following.
Run sudo python setup.py install. If you do not have sudo privileges, run python setup.py install --user or python setup.py install --prefix=<desired directory>.
You should see three new folders inside FAST-iCLIP: docs, rawdata, and results.
Add the following lines to your ~/.bashrc and ~/.bash_profile:
export FASTICLIP_PATH=~/.local/bin/
export PATH=$FASTICLIP_PATH:$PATH
Save the file, then run source ~/.bash_profile.
fasticlip -i rawdata/example_MMhur_R1.fastq rawdata/example_MMhur_R2.fastq --GRCm38 -s docs/GRCm38/GRCm38_STAR/ -n MMhur -o results. It should run in ~1 hour. Look inside results/MMhur for output files.The version numbers listed have been tested successfully. There can be difficulties if you choose to run updated versions of some of these dependencies.
At least one FASTQ or compressed FASTQ (fastq.gz). Use the --trimmed flag if trimming has already been done.
Three subdirectories inside the named directory within results.
figures has 6 figures in pdf and png format.
Figure 1 visualizes the some of the relevant summary data.
Figure 2 provides coverage histograms of binding across each repeat RNA element, both sense and antisense strands.
Figure 3 provides coverage histograms of binding across the rRNA, highlighting mature rRNA regions.
Figures 4a and 4b provide a summary of snoRNA binding data.
Figure 5 provides histograms of RT stop position within gene body for all remaining ncRNA types.
Figure 6 provides a pie chart composed of RT stops from the top 15 best bound endoVirus elements.
Figure 7 provides histograms of RT stop position across the genome for any exoViruses (DV, ZV, or HCV).
rawdata has all the PlotData files used to make the figures, as well as intermediate files that can be useful in generating other plots.
todelete has files that are unnecessary to keep.
Prepare 2 FASTQ or FASTQ.gz files corresponding to the two replicates for an iCLIP/irCLIP experiment.
Duplicate removal, quality filter, and trim adapter from the 3' end from the reads
Content type
Image
Digest
Size
1017.1 MB
Last updated
about 9 years ago
docker pull andypohl/fasticlip:conda