Sign inSign up

guanliangmeng/mitoz

By guanliangmeng

Updated over 3 years ago

MitoZ: A toolkit for assembly, annotation, and visualization of animal mitochondrial genomes

Image
4

7.4K

guanliangmeng/mitoz repository overview

Manual of MitoZ

See https://github.com/linzhi2013/MitoZ for the latest manual.

1. About MitoZ

MitoZ is a Python3-based toolkit which aims to automatically filter pair-end raw data (fastq files), assemble genome, search for mitogenome sequences from the genome assembly result, annotate mitogenome (genbank file as result), and mitogenome visualization. MitoZ is available from https://github.com/linzhi2013/MitoZ.

2. System requirment

2.1 Platform

MitoZ is developed and tested under Linux version 2.6.32-696.el6.x86_64 ([email protected]) (gcc version 4.4.7 20120313 (Red Hat 4.4.7-18) (GCC) ) #1 SMP Tue Mar 21 19:29:05 UTC 2017.

2.2 Harddisk space

>10 GB

2.3 Memory

It takes ~100G when we tested MitoZ with --thread_number 16. This is because MitoZ uses the de Bruijn graph (DBG) algorithm to perform de novo assembly. To learn more, see https://doi.org/10.1093/bioinformatics/btu077.

there are ways to reduce the memory usage:

  1. enrich the mitochondrion during experiment step (e.g. via gene capture array). This can lead to a higher mitochondrial derived reads ratio in the HTS data, and then you can use less data for MitoZ input, which can reduce memory usage of MitoZ.

  2. filter out the mitochondrial reads by mapping reads against mitogenomes of closely-related species (if any). provide such reads (a smaller volume of data) to MitoZ.

3. Get started

MitoZ includes multiple modules, including all, all2, filter, assemble, findmitoscaf, annotate and visualize.

Important: make sure you are in the mitozEnv environment when you run MitoZ!

$ source activate mitozEnv

see INSTALL.md for installation instruction.

Now create a directory for one sample:

$ mkdir ~/example
$ cd ~/example

4. Data requirement

4.1 Material source

The most preferable data for mitochondrial genome assembly is always data with high ratio of mitochondrial derived reads and little contamination. For example, tissue samples may be better than blood samples or gut samples.

4.2 Requirment of data size and insert size

About 1.5 to 3G base pair (bp) is enough for mitochondrial genome assembly.

e.g. raw.1.fq.gz and raw.2.fq.gz or clean.1.fq.gz and clean.2.fq.gz

The read length should be >= 71bp (PE71). Typically, I use data of PE100 or PE150 sequencing.

The length of read1 and read2 must be equal. You should trim your data (e.g. use the option --keep_region in filter function of MitoZ) before running MitoZ.

The insert size of pair-end library should be small insert size (<1000 bp). I do not recommend to use data of large insert size (>1000bp, mate-pair library), because this kind of data usually is not good as small insert size data.

4.3 Data pretreatment

MitoZ supports simple data pretreatment (remove low quality, many Ns reads, duplications), thus you can provide MitoZ the raw data (fastq files) from WGS experiments directly. In this case, you can use the all or filter module to perform data filtering.

Or, you can provide MitoZ the clean data, which have been filtered by other tools.

4.4 Modules support both single-end data and pair-end data

  • all

  • all2

  • filter

  • assemble

  • annotate

  • visualize

4.5 Modules support pair-end data only

  • findmitoscaf(needs fastq only when the input assembly (containing nuclear and mitochondrial sequences) is not from SOAPdenovo-Trans or mitoAssemble, to caculate the sequence sequencing depth)

4.6 Fasta file

When you annotate a mitogenome sequence(s) stored in fasta file, the sequence id can not be too long (≤16 characters), or MitoZ will fail. This is for some limitation in BioPython that MitoZ invokes. see more details on https://github.com/biopython/biopython/issues/526.

Make sure you sequence ID contains "topology=circular" or "topology=linear". MitoZ uses this tag to determine if a sequence is circular.

4.7 Genetic code

It is important to set a correct genetic code for MitoZ (--genetic_code option). Usually, arthropods use the invertebrate mitochondrial code (--genetic_code 5), and mammals use the vertebrate mitochondrial code (--genetic_code 2).Please refer to https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi for more details.

MitoZ use the genetic code for annotating the Protein coding genes (PCGs) of mitochondrial genome.

4.8 Taxa group

It is also important to set a correct taxa group for MitoZ (--clade option).

MitoZ use the --clade option to choose corresponding database (HMM modules, CM modules, protein reference sequences).

5. Supporting for specifying parameters in a configure file

Now MitoZ supports use a configure file to set the parameter, besides using the command line way (as the examples in the later sections).

5.1 create a configure file for desired module

For example,

$ python3 MitoZ.py all --create_config

will a file mitoz_all_config.txt, which contains the paramters same as output by python3 MitoZ.py all -h.

Then modify the file mitoz_all_config.txt as the instructions in the file.

The example configure file for each module has also been placed in the directory example_configure_files/

5.2 run the module

$ python3 MitoZ.py all --config mitoz_all_config.txt

6. all module

all module supports pair-end data and single-end data.

all module requires only two input pair-end fastq files, and outputs a genbank file containing mitochondrial genome sequences and annotation information.

Internally, all module runs filter, assemble, findmitoscaf, annotate and visualize module sequentially, which really makes MitoZ an "on-click" solution for mitogenome analysis from raw HTS data.

6.1 Input files

Pair-end(PE) fastq files (raw.1.fq.gz and raw.2.fq.gz), and optional files 1.adapter.list.gz and 2.adapter.list.gz.

6.2 Example

$ python3 MitoZ.py all --genetic_code 5 --clade Arthropoda --outprefix ZZZ \
--thread_number 12 \
--fastq1 raw.1.fq.gz \
--fastq2 raw.2.fq.gz \
--fastq_read_length 150 \
--insert_size 250  \
--run_mode 2 \
--filter_taxa_method 1 \
--requiring_taxa 'Arthropoda'

For more details, please refer to python3 MitoZ.py all -h

6.3 directory structure

example
    ├── ZZZ.tmp
    │   ├── ZZZ.annotation
    │   ├── ZZZ.assembly
    │   └── ZZZ.cleandata
    └── ZZZ.result
        ├── work71.hmmtblout.besthit.sim.filtered.high_abundance_10.0X.reformat.sorted.Not-picked
        ├── work71.hmmtblout.besthit.sim.filtered.high_abundance_10.0X.reformat.sorted.Not-picked.fa
        ├── work71.hmmtblout.besthit.sim.filtered.low_abundance
        ├── work71.hmmtblout.besthit.sim.filtered.low_abundance.fasta
        ├── work71.mitogenome.fa
        ├── work71.most_related_species.txt
        ├── ZZZ_mitoscaf.fa.gbf
        ├── ZZZ_mitoscaf.fa.sqn
        ├── ZZZ_mitoscaf.fa.tbl
        ├── ZZZ_mitoscaf.fa.val
        ├── errorsummary.val
        ├── ZZZ.fasta
        ├── ZZZ.cds
        ├── ZZZ.rrna
        ├── ZZZ.trna
        ├── ZZZ.misc_feature
        ├── circos.png
        ├── circos.svg
        ├── summary.txt
        └── README.txt

The intermediate files are in the tmp directory, and ZZZ.result contains the result files for your sample.

Files in ZZZ.result including:


  1. README.txt

A brief instruction about each file in the ZZZ.result directory.


  1. summary.txt

A summary about the mitogenome in ZZZ_mitoscaf.fa.gbf (or the *.mitogenome.fa file if you run assemble or findmitoscaf module), including a list of genes, numbers of genes recovered totally, what genes may be missing (if any), the sequence length, circularity, most closely related species.


  1. circos.png and circos.svg

Visualizations of the mitogenome in ZZZ_mitoscaf.fa.gbf.


  1. ZZZ_mitoscaf.fa.gbf, ZZZ.fasta, ZZZ_mitoscaf.fa.sqn and ZZZ_mitoscaf.fa.tbl.

The mitogenome files in different format. The sequences whose sequence ids have _FivePCGs suffixs (if any) are not considered as our mitogenome of target species, and they are output intendedly for further inspection by users. All sequences with ≥ 5 PCGs besides the mitochondrial sequences will be output by MitoZ intendedly.

If you run the assemble or findmitoscaf modules, the ZZZ.fasta file will be work71.mitogenome.fa. We do not rename work71.mitogenome.fa to be ZZZ.fasta to aovid overwriting the ZZZ.fasta file if you run MitoZ in multi-kmer mode.


  1. ZZZ.cds, ZZZ.rrna, ZZZ.trna and ZZZ.misc_feature

The individual gene sequences in fasta format, extracted from ZZZ_mitoscaf.fa.gbf.


  1. ZZZ_mitoscaf.fa.val and errorsummary.val

The two files are generated by NCBI's tbl2asn program, describing related warnings and errors for file ZZZ_mitoscaf.fa.gbf. Thus, you should check this file to confirm if there are any assembly or annotation problems.

For example, an InternalStop for protein coding genes can be caused by assemlby (e.g., there are Ns, or assembly errors), annotation, mutation, incorrect genetic code, or the sequence simply comes from nuclear mitochondrial DNA segments (NUMTs). You may inspect the sequencing depth distribution of sequences around such regions from the visualization result files (circos.png and circos.svg).


  1. work71.mitogenome.fa and work71.most_related_species.txt

The mitogenome sequences from each kmer (e.g. kmer 71) assembly and their most closely related species.

  • If you run all or all2 module, you can ignore the two files, work71.mitogenome.fa is the same as ZZZ.fasta file, while work71.most_related_species.txt is the same as ZZZ.most_related_species.txt.

  • If you run assemble or findmitoscaf module, the work71.mitogenome.fa or outprefix.mitogenome.fa is your mitogenome file.

  • If you run MitoZ in multi-kmer mode, if one kmer assembly has very good results, then you can just use these two files as your mitogenome files, instead of the file outprefix.multiKmer_seq_picked.clean.fa (describled in section 13.1 as below)


Below file are not part of the final mitogenome results, but are output just in case the users want to know more about those information instead of the mitogeome of target species.

  1. work71.hmmtblout.besthit.sim.filtered.high_abundance_10.0X.reformat.sorted.Not-picked, work71.hmmtblout.besthit.sim.filtered.high_abundance_10.0X.reformat.sorted.Not-picked.fa, work71.hmmtblout.besthit.sim.filtered.low_abundance and work71.hmmtblout.besthit.sim.filtered.low_abundance.fasta

These *.low_abundance* and *.high_abundance* files, which are the sequences with low abundances or high abundances but not selected as outputs by MitoZ.

These sequences, together with the sequences whose sequence ids have _FivePCGs suffixs in ZZZ_mitoscaf.fa.gbf and ZZZ.fasta (if any), may be useful if, for example, you want to find potential NUMTs, or want to know if there are some sequences of non-target-species.


When you use other modules, some of those files (directories) may be absent.

7 all2 module

all2 module supports single-end data and pair-end data.

all2 is amolst the same as all, except that all2 doesn't filter the input fastq files.

Internally, all2 module runs assemble, findmitoscaf, annotate and visualize module sequentially.

7.1 Input files

Pair-end(PE) fastq files (clean.1.fq.gz and clean.2.fq.gz).

7.2 Example

For pair-end data:

$ python3 MitoZ.py all --genetic_code 5 --clade Arthropoda --outprefix test \
--thread_number 8 \
--fastq1 clean.1.fq.gz \
--fastq2 clean.2.fq.gz \
--fastq_read_length 150 \
--insert_size 250 \
--run_mode 2 \
--filter_taxa_method 1 \
--requiring_taxa 'Arthropoda'

For single-end data:

$ python3 MitoZ.py all --genetic_code 5 --clade Arthropoda --outprefix test \
--thread_number 8 \
--fastq1 clean.1.fq.gz \
--fastq_read_length 150 \
--insert_size 250 \
--run_mode 2 \
--filter_taxa_method 1 \
--requiring_taxa 'Arthropoda'

8. filter module

filter module supports pair-end data and single-end data.

filter is to filter input raw fastq files (raw.1.fq.gz and raw.2.fq.gz), outputs clean fastq files (clean.1.fq.gz and clean.2.fq.gz)

8.1 Input files

Pair-end(PE) fastq files (raw.1.fq.gz and raw.2.fq.gz), and optional files 1.adapter.list.gz and 2.adapter.list.gz.

8.2 Example

$ python3 MitoZ.py filter \
--fastq1 raw.1.fq.gz \
--fastq2 raw.2.fq.gz \
--fastq3 clean.1.fq.gz \
--fastq4 clean.2.fq.gz \
--outprefix test

9. assemble module

assemble module supports single-end data and pair-end data.

assemble is to assemble clean.1.fq.gz and clean.2.fq.gz, search for mitochondrial sequences from the assembly. Output is a mitochondrial sequence file in fasta format.

Internally, assemble module will assemble the nuclear + mitochondrial genomes firstly with the input fastq files, then invoke findmitoscaf module to find out the mitogeome.

9.1 Input files

Pair-end(PE) fastq files (clean.1.fq.gz and clean.2.fq.gz).

9.2 Example

For pair-end data:

$ python3 MitoZ.py assemble --genetic_code 5 --clade Arthropoda --outprefix test \
--thread_number 8 \
--fastq1 clean.1.fq.gz \
--fastq2 clean.2.fq.gz \
--fastq_read_length 150 \
--insert_size 250 \
--run_mode 2 \
--filter_taxa_method 1 \
--requiring_taxa 'Arthropoda'

For single-end data:

$ python3 MitoZ.py assemble --genetic_code 5 --clade Arthropoda --outprefix test \
--thread_number 8 \
--fastq2 clean.2.fq.gz \
--fastq_read_length 150 \
--insert_size 250 \
--run_mode 2 \
--filter_taxa_method 1 \
--requiring_taxa 'Arthropoda'

10. findmitoscaf module

findmitoscaf module supports pair-end data only.

findmitoscaf is to search for the mitochondrial sequences from fasta file which contains non-mitochondrial sequences. Output is a mitochondrial sequence file in fasta format.

10.1 Input files

  • work71.scafSeq

A file contains non-mitochondrial sequences.

If work71.scafSeq is generated by SOAPdenovo-Trans or mitoAssemble, you can specify the option --from_soaptrans, and in this case, work71.scafSeq is the only input file you need.

Otherwise, you still need following two files as input,

  • clean.1.fq.gz and clean.2.fq.gz

10.2 Example

$ python3 MitoZ.py findmitoscaf --genetic_code 5 --clade Arthropoda --outprefix test \
--thread_number 8 \
--from_soaptrans \
--fastafile work71.scafSeq

Or,

$ python3 MitoZ.py findmitoscaf --genetic_code 5 --clade Arthropoda \
--outprefix test --thread_number 8 \
--fastq1 clean.1.fq.gz \
--fastq2 clean.2.fq.gz \
--fastq_read_length 150 \
--fastafile work71.scafSeq

11. annotate module

annotate module supports single-end and pair-end data.

annotate is to annotate the input mitogenome sequence, including protein coding genes (PCGs), tRNA genes and rRNA genes. Output is a genbank file containing mitochondrial genome sequences and annotation information.

Make sure you sequence ID contains "topology=circular" or "topology=linear". MitoZ uses this tag to determine if a sequence is circular.

11.1 Input files

e.g. mitogenome.fa

A fasta file containing the mitochondrial seqeunces.

11.2 Example

$ python3 MitoZ.py annotate --genetic_code 5 --clade Arthropoda \
--outprefix test --thread_number 8 \
--fastafile mitogenome.fa

If you want to see the abundance along the mitogenome sequences, you will also need to set --fastq1 and/or --fastq2.

12. visualize module

visualize module supports single-end and pair-end data.

visualize module is to visualize the genbank file.

There are three circles in the result figure, where the innermost one shows the GC content, which is calculated based on a window-sliding method. For the middle circle, that reveals the depth distribution, with dark green for the outline. If the depth lower than the minimum value (default 20), it turns red, whereas if the depth larger than upper quartile, it turns dark green as same with the outline. And for the outermost circle, it obviously shows the gene features, orange for rRNA, red for tRNA, and blue for CDS. By the way, the feature color can be defined by users. Users can also add a customed image (i.e. a aniaml picture) as background (see the print help information of visualize module).

12.1 Input files

e.g. mitogenome.gb

A Genbank file.

12.2 Example

$ python3 MitoZ.py visualize --gb mitogenome.gb

If you want to show sequencing depth along the mitogenome, you need to set --fastq1 and/or --fastq2 or --depth.

13. Multi-Kmer mode

when there are missing PCGs after you run MitoZ in quick mode (--run_mode 2), you can try with the multi-Kmer mode (--run_mode 3).

You should provide the quick mode assembly as input, including files:

  1. work71.hmmout.fa, or a file (e.g. quickMode.fa) which you convince containing the correct mitogenome sequences for your sample. And manually create a file (e.g. quick_mode_fa_genes.txt) describing what PCG genes on each sequence, format:

     seqid1 PCG1 PCG2
     seqid2 PCG3
    
  2. work71.hmmtblout.besthit.sim.filtered.fa

  3. work71.hmmtblout.besthit.sim.filtered.high_abundance_*X.reformat.sorted

in the directory of outprefix.assembly.

13.1 Example

$ python3 MitoZ.py all2 --genetic_code 5 --clade Arthropoda --outprefix test \
--thread_number 12 --fastq1 clean.1.fq.gz --fastq2 clean.2.fq.gz \
--fastq_read_length 150 --insert_size 250 \
--run_mode 3 \
--filter_taxa_method 1 \
--requiring_taxa 'Arthropoda' \
--quick_mode_seq_file quickMode.fa \
--quick_mode_fa_genes_file quick_mode_fa_genes.txt  \
--missing_PCGs ND4L ND6 ND2 \
--quick_mode_score_file work71.hmmtblout.besthit.sim.filtered.high_abundance_10.0X.reformat.sorted  \
--quick_mode_prior_seq_file work71.hmmtblout.besthit.sim.filtered.fa

The result file is outprefix.multiKmer_seq_picked.clean.fa under directory outprefix.assembly2.

14. Rearrangement of mitogenome basing on reference mitogeome

use the script useful_scripts/Mitogenome_reorder.py manually.

Reorder your mitochondrial genome sequence so as to be same with your reference. this is potenially needed becasue assember do not break mitogenome in "0" position for some reasons.

Additionally, you can give a set of primer which is close to 0 position of mitogenome, (e.g. F15: CACCCTATTAACCACTCACG for human) so I can use this information to adjust the sequence order.

It supports three modes: (i). -f, using a reference guide; (ii). -p, using a human mitogenome primer set in a certain list(F15 or F361). However, it assumes that your primer is identical to sequence, complementary or reverse primer not acceptable!

If your mitogenome is circular, final reordered mitogenoem will be merely adjusted link orientation, if not, program will add 100 N between portions.

14.1 Usage

$ python3 Mitogenome_reorder.py  -f mito.fasta -r ref.fasta
$ python3 Mitogenome_reorder.py  -f mito.fasta -p L15

14.2 Optional arguments:

  -h, --help  show this help message and exit
  -f FILE     your mitogenome fasta
  -r FILE     reference fasta
  -p STR      primer set for [F15, F361], this is only for human
  -m INT      mismatch threshod for primer anchoring

14.3 Tips

  • Make sure you sequence ID contains "topology=circular" or "topology=linear", this is important!
  • If you want to use your own sequnce as primer bait, you can modify this python script, add you priemr sequence as a pair of KEY-VALUSE to dict of "primers", and make sure the numer is accurate, e.g. F15 means that primer starts at 15th base in sequnce.
  • Primer sequence can contain a degenerate base, like R, Y, M ...

15. Other useful scripts

15.1 To handle a Genbank file

use the script useful_scripts/genbank_file_tool.py.

$ python3 genbank_file_tool.py
usage: genbank_file_tool.py [-h] {cut,comrev,sort,select} ...

Description
    A tool to deal with genbank records.

Version
    0.0.1

Author
    mengguanliang(at) genomics (dot) cn, BGI-Shenzhen.

positional arguments:
  {cut,comrev,sort,select}
    cut                 cutting sequences (5' and/or 3' end).
    comrev              get complement reverse of genbank records
    sort                sort the gene orders (input should all be circular
                        records!!!)
    select              output specific genbank records

optional arguments:
  -h, --help            show this help message and exit

15.2 To check if the sequence is circular

use the script useful_scripts/circle_check.py.

    $ python3 circle_check.py

    Description

        Checking whether the sequences are circular when the sequences have
        length >= 12Kbp

    Usage

        python3 circle_check.py  <in.fasta>  <outPrefix> <mismatch_allowed>

    output files:

    1. <outPrefix>.mitogenome.fa
    All the sequences from <in.fasta>.

    The sequence id line will be like:
    >C1 topology=circular
    >C2 topology=linear

    For the circular mt sequence, the overlapping region (the second `ATGCNN`
    below) has been removed (below is an example)

    ATGCNNNNN[ATGCNN]

    Assuming `ATGCNNNNN` is a circular mt sequence, `ATGCNN` are the overlapping
    regions.

    2. <outPrefix>.start2end_for-circular-mt-only
    This file contains the circular sequences only, and the first 300 bp of each
    has been moved to the end of the sequence, just for better reads mapping. You
    can check the sequencing depth around the 'joining site' (-300 bp) using the
    `annotate` module of MitoZ, to confirm if the sequence is really circular.

    3. <outPrefix>.overlap_information
    The overlapping sequence detected for the circular sequences.

15.3 Extract gene sequences from Genbak file

use the script useful_scripts/gbseqextractor_v2.py.

usage: gbseqextractor_v2.py [-h] -f <STR> -prefix <STR> [-seqPrefix <STR>]
                         [-types {CDS,rRNA,tRNA,wholeseq} [{CDS,rRNA,tRNA,wholeseq} ...]]
                         [-gi] [-p] [-t] [-s] [-l] [-rv] [-F]

extract any CDS or rNRA or tRNA DNA sequences of genes from Genbank file.
Note: the position on ID line is 1-leftmost! Seqid will be the value of
'/gene=' or '/product=', if they both were not present, the gene will not be
output!

optional arguments:
  -h, --help            show this help message and exit
  -f <STR>              Genbank file
  -prefix <STR>         prefix of output file.
  -seqPrefix <STR>      prefix of each seq id. default: None
  -types {CDS,rRNA,tRNA,wholeseq} [{CDS,rRNA,tRNA,wholeseq} ...]
                        what kind of genes you want to extract? wholeseq for
                        whole fasta seq.[CDS]
  -gi                   use gi number as sequence ID instead of accession
                        number when gi number is present. (default: accession
                        number)
  -p                    output the position information on the ID line.
                        1-leftmost, same as in the Genbank file. [False]
  -t                    output the taxonomy lineage on ID line [False]
  -s                    output the species name on the ID line [False]
  -l                    output the seq length on the ID line [False]
  -rv                   reverse and complement the sequences if the gene is on
                        minus strand [False]
  -F                    only output full length genes [False]

15.4 Dispatch same genes of different samples into same files

usage: same_gene_to_same_file.py [-h] [-r <file>] [-d <str>] [-p <str>]

To dispatch the same genes of different samples into same files.

optional arguments:
  -h, --help  show this help message and exit
  -r <file>   the gene file list. Per-line format: Abbreviation geneFilePath.
              The abbreviation will be added to the seqid to indicate
              different samples.
  -d <str>    the delimiter between the abbreviation and the seqid [;]
  -p <str>    the prefix of all result files [MitoZ]

Citation

Guanliang Meng, Yiyuan Li, Chentao Yang, Shanlin Liu, MitoZ: a toolkit for animal mitochondrial genome assembly, annotation and visualization, Nucleic Acids Research, , gkz173, https://doi.org/10.1093/nar/gkz173

Tag summary

Content type

Image

Digest

sha256:11c9acb85

Size

2.2 GB

Last updated

over 3 years ago

docker pull guanliangmeng/mitoz:3.6