Sign inSign up

matsen/spurf

By matsen

•Updated over 8 years ago

Substitution Profiles Using Related Families

Image
0

158

matsen/spurf repository overview

This code repository contains a command line implementation of SPURF, that takes a single antibody heavy chain DNA sequence and returns its inferred substitution profile and a logo plot of this. SPURF uses cached data from a large-scale Rep-Seq dataset as input to a statistical model made to determine a detailed clonal family specific substitution profile for a single input sequence. Source code to fit the SPURF model from scratch using another dataset is also provided.

⁠Cloning this repo

Clone this GitHub repo recursively to get the necessary submodules:

git clone --recursive https://github.com/krdav/SPURF.git
cd SPURF
git pull --recurse-submodules https://github.com/krdav/SPURF.git
⁠Installation

There are two supported ways of installing the command line implementation of SPURF: 1) using Conda on Linux and 2) using Docker and the provided Dockerfile. The Conda installation has been tested on our own servers and a fresh Ubuntu installation on a VirtualBox. Using VirtualBox, SPURF can be installed on both Mac and Windows. Alternatively, Docker can also be used on any platform that supports it.

⁠Using Conda

First, install Conda⁠ for Python 2. Miniconda is sufficient and much faster at installing. Remember to source ~/.bashrc if continuing installing in the same terminal window.

Install dependencies with apt-get:

sudo apt-get update
sudo apt-get upgrade -y
sudo apt-get install -y libz-dev cmake scons libgsl0-dev libncurses5-dev libxml2-dev libxslt1-dev mafft hmmer

Use the INSTALL executable to install the required python environment and partis (via ./INSTALL). After installation, the Conda environment needs to be loaded every time before use, like this:

source activate SPURF
⁠Using Docker

First install Docker⁠.

We have a Docker image on Docker Hub⁠ that is automatically kept up to date with the master branch of this repository. It can be pulled and used directly:

sudo docker pull krdav/spurf

Alternatively you can build the container yourself from inside the main repository directory:

sudo docker build -t spurf .

To run this container, use a command such as (see modifications below)

sudo docker run -it -v host-dir:/host krdav/spurf /bin/bash
  • replace host-dir with the local directory to which you would like access inside your container
  • replace /host with the place you would like this directory to be mounted
  • if you built your own container, use spurf in place of krdav/spurf

Detach using ctrl-p ctrl-q.

⁠Running SPURF

SPURF is wrapped into an Rscript named run_SPURF.R that takes three inputs:

  1. an antibody heavy chain DNA sequence
  2. (optional) the basename for the two output files which are a substitution profile and a logo plot
  3. the model type (i.e. l2 or jaccard).

Example run:

Rscript --vanilla run_SPURF.R <input_sequence> <output_base> <model_type>

E.g.:

Rscript --vanilla run_SPURF.R CGCAGGACTGTTGANGCCTTCGGAGACCCTGTCCCTCACCTGCGTTGTCTCTGGCGGGTCCTTCAGTGATTACTACTGGAGCTGGATCCATCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCAATCATAGTGGGAGCACCAACTACAACCCGTCCCTCGAAAGTCGAGCCACCATATCAGTAGACACGTCCCAGAACAACCTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACTCGGCTGTGTATTACTGTGCGAGAGGCCCGACTACAATGGCTCACGACTTTGACTACTGGGGCCAGGGAACCCTGGTCACC seqXYZ_SPURF_output l2

By default, the model type l2 is used.

⁠Output example

Output logo plot

Zooming in on CDR2 and its flanking frameworks: Output logo plot cut

Tag summary

Content type

Image

Digest

Size

2.9 GB

Last updated

over 8 years ago

docker pull matsen/spurf