myBrain-Seq: a Compi pipeline for miRNA-Seq data analysis in neuropsychiatry
1.2K
myBrain-Seq is a Compi pipeline for miRNA-Seq analysis of neuropsychiatric data. A Docker image is available for this pipeline in this Docker Hub repository.
MyBrain-Seq is a Compi pipeline for performing full analyses of miRNA-Seq data, with particular interest on neuropsychiatric data.
It can automatically identify differentially expressed microRNAs (DE miRNAs) between two conditions using two differential expression analysis software, namely DESeq2 and EdgeR, and is able to offer an integrated result suitable for experimental validation. Additionally, a functional analysis module puts biological meaning behind the list of DE miRNAs and eases the process of biomarker identification.
Its features and analysis are designed and tuned to work with miRNA data. We designed myBrain-Seq with the particularities of neuropsychiatric data in mind. In this way, myBrain-Seq addresses its most common limitations while offering results that help the investigator to identify potential biomarkers and molecular mechanisms for the studied conditions. When more than two conditions are involved, myBrain-Seq facilitates performing all the pairwise comparisons of interest.
A typical analysis with myBrain-Seq comprises the following steps, which are further detailed below:
Prepare the input FastQ files for the differential expression analysis. This process comprises:
After the preprocessing was completed, myBrain-Seq performs the differential expression analysis. This process comprises:
In addition, the user can instruct myBrain-Seq to generate a genome index for the Bowtie alignment; this index will be built in parallel with the preprocessing tasks.
After the differential expression analysis, myBrain-Seq performs a functional analysis. This process comprises:
Finally, a single MultiQC report is generated to summarize the results of the quality, alignment, assignment and quantification of all the samples.
To perform a myBrain-Seq analysis users must first:
This section provides a comprehensive guide on how to perform these steps and the tools and scripts included in the myBrain-Seq image to do it easily.
Some steps on the preparation of myBrain-Seq analysis require either to adapt and run code on a console or to use myBrain-Seq's terminal user interface (v.console). As the v.console can perform several operations, please refer to this section whenever you need to use it. To launch the v.console just run the following command on a terminal:
docker run --rm -it -v /var/run/docker.sock:/var/run/docker.sock -v /tmp:/tmp singgroup/my-brain-seq visual_console.sh
An interactive menu should be displayed in your terminal.
To start a new analysis, the first thing to do is build the directory tree in your local file system. This directory tree will be referred as the working directory and its structure is recognized and used by the pipeline during the analysis.
MyBrain-seq offers two options to generate the working directory: interactively using myBrain-Seq's terminal user interface (v.console) or adapting and running a command in the console.
Run the v.console (see section "Running the v.console") and select the option "Initialize the working-directory"; then, paste the full path where the "working-directory" should be placed and confirm.
To build the working directory adapt the first line of the following code and run it:
WORKING_DIRECTORY=/path/to/the/working-directory
docker run --rm -v ${WORKING_DIRECTORY}:${WORKING_DIRECTORY} -u "$(id -u)":"$(id -g)" singgroup/my-brain-seq init_working_dir.sh ${WORKING_DIRECTORY}
After completing any of the above options, the selected working-directory (mbs_project in the example below) should have the following structure:
/home/user/mbs-project
|-- README.txt
|-- input
| |-- compi.parameters
| |-- conditions_file.txt
| `-- contrast_file.txt
|-- output
`-- run.sh
Where:
The creations of these files is detailed in the following sections as well as briefly indicated in the README.txt file. You may find it convenient to create additional directories and files within the working directory to group all the data related to a particular study.
compi.parameters fileThe compi.parameters file is used by myBrain-Seq to locate the files needed for the analysis as well as to define which optional tasks will be run. Here is an example of a compi.parameters file using the working directory created in the previous example:
workingDir=/path/to/mbs-project
fastqDir=/path/to/study_1/data/
gffFile=/path/to/study_1/refs/mirbase_hsa.gff3
conditions=/path/to/mbs-project/input/conditions_file_study_1.txt
contrast=/path/to/mbs-project/input/contrast_file_study_1.txt
bwtIndex=/path/to/study_1/refs/bowtie-index_GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set
adapter=TGGAATTCTCGGGTGCCAAGG
organism=Homo sapiens
This file contains the following mandatory parameters:
And the following optional parameters:
conditions_file.txt fileThe conditions_file.txt is a TSV file used by myBrain-Seq to link each fastQ file with its condition. This information will be used to choose the group of samples to compare in the differential expression analysis. Here is an example of a conditions file:
name condition label sex alcohol
C019 control C_before_treatment M 0
C020 control C_before_treatment M 1
C021 control C_after_treatment F 0
C022 control C_after_treatment F 1
P012D FE FE_before_treatment M 1
P013A FE FE_before_treatment F 0
P014A FE FE_after_treatment M 0
P015D FE FE_after_treatment F 1
P014A SEP SEP_before_treatment M 1
P015D SEP SEP_before_treatment F 0
In order to obtain a file with a valid format, the following considerations must be taken into account:
contrast_file.txt fileThe contrast_file.txt is used by myBrain-Seq to perform the comparisons between samples of two different conditions in the differential expression analysis. Each line on this file corresponds with a contrast that myBrain-Seq has to perform. Here is an example of a contrast file:
name
"Control-First_episode" = "C-FE"
"Control-Second_episode" = "C-SEP"
"First_episode-Second_episode" = "FE-SEP"
The first line of contrast_file.txt is the header, the following lines begin with the contrast label (left side of the equal sign) and the factors to compare (right side of the equal sign). In order to obtain a file with a valid format, the following considerations must be taken into account:
"Label_A-Label_B" = "Factor_A-Factor_B"conditions_file.txt.Once all the required files were built, to start myBrain-Seq analysis run the script "run.sh" placed on the root of the working directory. This also can be done interactively by using the v.console (see section "Running the v.console"). To run the script manually adapt the following code:
/path/to/working-dir/run.sh /path/to/compi.parameters
Some tasks may produce errors that do not cause the pipeline to fail, but they can be important. Such errors are reported in the log files produced in the logs directory of the pipeline working directory. Inside this directory myBrain-Seq will create additional directories with the logs of each execution, they will be named with the date and hour of the analysis. Files containing the errors are saved with extension *.err.log, whereas normal output is saved with extension *.out.log.
These are the pipeline parameters:
workingDir: The working directory of the project.
fastqDir: The directory containing the fastq files (default is relative to workingDir).
outDir: The directory containing the pipeline outputs (relative to workingDir).
adapter: The sequence of the adapter to remove.
genome: The directory path to the genome to align.
bwtIndex: The directory path containing the Bowtie index.
gffFile: The path to the .gff file of the reference genome.
gffFeature: Feature of the .gff file to use for the annotations (eg.: miRNA, gene, transcript...), default miRNA.
gffAttribute: Attribute of the .gff to use in the annotations (eg.: Name, gene_id, transcript_id...), default Name.
conditions: The path to the .tsv file with the rootnames of the samples, conditions and labels.
contrast: The path to the .tsv file with the contrast DESeq2 has to perform.
vennFormat: The file format of the Venn diagram (png/svg/tiff), default png.
fqcOut: The relative path to the directory containing the FastQC results.
ctdOut: The relative path to the directory containing the Cutadapt results.
bwtOut: The relative path to the directory containing the Bowtie results.
bamstOut: The relative path to the directory containing the Samtools stats and Plot-bamstats results.
ftqOut: The relative path to the directory containing the FeatureCounts results.
dsqOut: The relative path to the directory containing the DESeq2 results.
edgOut: The relative path to the directory containing the EdgeR results.
deaIntOut: The relative path to the directory containing the results of the DESeq2 and EdgeR integration.
scriptsDir: The relative path to the directory containing the R script to run the DESeq2 analysis.
testAdapterBashScript: The relative path to the directory containing the R script to get the path of the aligned/unaligned data.
deSeq2Rscript: The relative path to the directory containing the R script to run the DESeq2 analysis.
filterCtsRscript: The relative path to the directory containing the R script used to filter all-counts.txt and conditions_file.
edgerRscript: The relative path to the directory containing the R script to run the EdgeR analysis.
enhancedVolcanoRscript: The relative path to the directory containing the R script to build the Volcano plot.
deaIntRscript: The relative path to the directory containing the R script to run the DESeq-EdgeR results integration.
vennRscript: The relative path to the directory containing the R script to run the DESeq-EdgeR results integration.
rDeseq2Version: Version of the pegi3s/r_deseq2 Docker image to use.
rEdgerVersion: Version of the pegi3s/r_edger Docker image to use.
rEnhancedVolcanoVersion: Version of the pegi3s/r_enhanced-volcano Docker image to use.
cutadaptVersion: Version of the pegi3s/cutadapt Docker image to use.
fastqcVersion: Version of the pegi3s/fastqc Docker image to use.
bowtieVersion: Version of the pegi3s/bowtie1 Docker image to use.
featureCountsVersion: Version of the pegi3s/feature-counts Docker image to use.
samtoolsVersion: Version of the pegi3s/samtools_bcftools Docker image to use.
samtoolsBamstatsVersion: Version of the pegi3s/samtools_bcftools Docker image to use for bam analysis.
rdatanalysisVersion: Version of the pegi3s/r_data-analysis Docker image to use.
rVennVersion: Version of the pegi3s/r_venn-diagram Docker image to use.
skipPullDockerImages: Use this flag to skip the pull-docker-images task.
selectDEAsoftware: Use this param to select the differential expression analysis software (deseq, edger or both).
The sample data is available here. Download and decompress it to get a directory named working-dir that contains an example of a functional working directory, were the data and biological references were grouped within it. Here you can find:
input, with the compi.parameters, condition_file.txt and contrast_file.txt of this particular study.data, with the fastQ files of the study, the Bowtie index and the miRNA annotations.To run the pipeline with this test data, edit the compi.parameters (at /working-dir/input) and modify the paths to adapt them to the absolute location of the working directory in your computer (e.g.: workingDir=/working-dir could be workingDir=/home/user/working-dir). After doing this, just run the run.sh script included.
To build the Docker image, compi-dk is required. Once you have it installed, simply run compi-dk build -drd -tv from the project directory to build the Docker image. The image will be created with the name specified in the compi.project file. This file also specifies the version of compi that goes into the Docker image.
The pipeline version is set in the <version> section of the pipeline.xml. Nevertheless, as the version number is referenced from other sites, it is recommended to update it using the following command:
./resources/development/set-new-version.sh $(pwd) <new_version>
MyBrain-Seq is a pipeline developed by the SING and NeuroEpigenetics Lab groups.
, [email protected]
, [email protected]
, [email protected]Content type
Image
Digest
sha256:f11d5b7f0…
Size
489.1 MB
Last updated
6 months ago
docker pull singgroup/my-brain-seq